| Научный журнал
 ЭКСПРЕССИЯ АКВАПОРИНОВ 1 И 5 В ЛЕГКИХ КРЫС ПОСЛЕ ВНУТРЕННЕГО ВОЗДЕЙСТВИЯ РАДИОАКТИВНЫМ ПОРОШКОМ 56MnO2 | статьи | Научный журнал

ЭКСПРЕССИЯ АКВАПОРИНОВ 1 И 5 В ЛЕГКИХ КРЫС ПОСЛЕ ВНУТРЕННЕГО ВОЗДЕЙСТВИЯ РАДИОАКТИВНЫМ ПОРОШКОМ 56MnO2

Опубликовано: 15-09-2017
Автор(ы): Ынкар О. Кайрханова 1, httр://оrcid.оrg/0000–0001–9533–1723 Нариаки Фуджимото 2, httр://оrcid.оrg/0000–0002–8570–4001 Найля Ж. Чайжунусова 1, httр://оrcid.оrg/0000–0002–6660–7118 Масахару Хоши 2, httр://оrcid.оrg/0000–0001–6978–0883 Валерий Ф. Степаненко 3, http://orcid.org/0000-0002-3541-0515 1Государственный Медицинский Университет города Семей, г. Семей, Казахстан; 2 Университет Хиросимы, г.Хиросима, Япония. 3 Медицинский радиологический научный центр им. А.Ф. Цыба – филиал федерального государственного бюджетного учреждения «Национальный медицинский исследовательский радиологический центр» Министерства здравоохранения Российской Федерации, г. Обнинск, Российская Федерация;

УДК 616.24-614.876+577.21+616-092.4

 

ЭКСПРЕССИЯ АКВАПОРИНОВ 1 И 5 В ЛЕГКИХ КРЫС ПОСЛЕ ВНУТРЕННЕГО ВОЗДЕЙСТВИЯ РАДИОАКТИВНЫМ ПОРОШКОМ 56MnO2

 

Ынкар О. Кайрханова 1, httр://оrcid.оrg/0000–0001–9533–1723

Нариаки Фуджимото 2, httр://оrcid.оrg/0000–0002–8570–4001

Найля Ж. Чайжунусова 1, httр://оrcid.оrg/0000–0002–6660–7118

Масахару Хоши 2, httр://оrcid.оrg/0000–0001–6978–0883

Валерий Ф. Степаненко 3, http://orcid.org/0000-0002-3541-0515

 

1Государственный Медицинский Университет города Семей, г. Семей, Казахстан;

2 Университет Хиросимы, г.Хиросима, Япония.

3 Медицинский радиологический научный центр им. А.Ф. Цыба – филиал федерального государственного бюджетного учреждения «Национальный медицинский исследовательский радиологический центр» Министерства здравоохранения Российской Федерации, г. Обнинск, Российская Федерация;

 

Введение. Радионуклид 56Mn (T1/2 = 2,58 час) является одним из доминирующих гамма- и бета-излучателей в начальный период после нейтронной активации почвы и элементов зданий, поднявшихся в воздух в виде пыли после ядерных взрывов. С целью моделирования экспозиции пылевидными микрочастицами 56Mn O2, были проведены эксперименты при воздействии на экспериментальных крыс диспергированным порошком 56MnO2,полученным в результате нейтронной активации стабильных атомов Mn на ядерном реакторе.

Цель. Изучить влияние воздействия диспергированным 56MnO2 на экспрессию генов в легких крыс.

Материалы и методы. Дизайн исследования: экспериментальный. В экспериментах были использованы крысы-самцы линии Вистар в возрасте 10 недель, масса которых составляла 220 – 330 г. Всего было использовано 58 животных. Крысы были разделены на 5 групп: 56MnO2 (0,05 Гр), 56MnO2 (0,11 Гр), MnO260Co и контроль. По 3 крысы каждой группы было умерщвлено и исследовано на 3, 14 и 60 сутки после воздействия. Статистический анализ. Все значения выражены в виде средних величин ± стандартная ошибка (S.E.). Использовали t-критерий Стьюдента для сравнения между экспонированными и контрольными группами. Было принято считать достоверными изменения экспрессии генов по сравнению с контролем при p <0,01 или p <0,05.

Результаты. Установлено, что после воздействия диспергированным 56Mn при дозе внутреннего облучения легких 0,05 Гр и 0,11 Гр, экспрессия гена AQP1 была увеличена только на 3-и сутки, а экспрессия гена AQP5 была увеличена на третьи, 14-е и 60-е сутки после воздействия. Интересно отметить, что внешнее 60Co гамма-облучение в дозе 2 Гр не изменяет экспрессию этих генов по сравнению с контролем, за исключением кратковременного (на третьи сутки) повышения экспрессии гена AQP5.

Выводы. Все это позволяет предположить, что воздействие распыленными микрочастицами 56MnO2, даже при малых средних дозах внутреннего облучения легких (0,11 Гр), оказывает весьма значительное биологическое воздействие на этот орган, о чем свидетельствует изменение уровней экспрессии генов AQP5 в течение весьма длительного периода времени – по сравнению с внешним гамма-облучении 60Со в существенно больших дозах (2 Гр). Воздействие диспергированным нерадиоактивным MnO2 не привело к изменению экспрессии изучаемых генов по сравнению с контролем.

Ключевые слова: Марганец-56, радиационно-индуцированные повреждения легких, внутреннее облучение, крысы, атомные бомбардировки.

 

Summary

 

THE EXPRESSION OF AQUAPORINS 1 AND 5 IN RAT LUNG AFTER INTERNAL EXPOSE TO RADIOACTIVE56MnO2POWDER

 

Ynkar O. Kairkhanova ¹, httр://оrcid.оrg/0000–0001–9533–1723

Nariaki Fujimоtо 2,httр://оrcid.оrg/0000–0002–8570–4001

Nailya Zh. Chaizhunusоva 1, httр://оrcid.оrg/0000–0002–6660–7118

Masaharu Hоshi 2, httр://оrcid.оrg/0000–0001–6978–0883

Valеrij F. Stерanеnkо 3, http://orcid.org/0000-0002-3541-0515

 

1Semey State Medical University, Semey, Republic of Kazakhstan;

2 Hiroshima University, Hiroshima Japan;

3 A. Tsyb Medical Research Radiological Center (MRRC) – National Medical Research Radiological Center Ministry of Health of Russian Federation, Obninsk, Russian Federation.

 

Introduction: The radionuclide 56Mn (T1/2=2.58 hours) is one of the dominant beta- and gamma-emitters within few hours after the neutron irradiation of soil dust following nuclear explosion in atmosphere. The effects of exposure to residual radioactivity from nuclear explosions are the subject of discussions and research of the consequences of nuclear tests and the atomic bombing. In order to simulate the exposure of 56MnO2 pulverized microparticles, experiments were carried out when the experimental rats were exposed to 56MnO2 dispersed powder obtained as a result of neutron activation of stable Mn atoms on a nuclear reactor.

Aim: To study the effect of dispersed 56MnO2 on the expression of genes in rat lung.

Materials and methods: Study design: experimental. In the experiments were used ten week-old male Wistar rats, the mass of which was 220-330 g. A total of 58 animals were used. The rats were divided into 5 groups: 56MnO2 (0.05 Gy), 56MnO2 (0.11 Gy), MnO2, 60Co and control.Animals were examined on days 3, 14 and 60 after exposure. Statistical analysis.All values are presented as mean ± standard error (SEM). Students t-test was performed to compare between the control and the radiation- exposed groups. Indicate significantly different from each contol level by p<0.01 and p<0.05.

Results: On day 3 after 56Mn exposure, the expression of aquaporin 1 (AQP1) increased. These changes were persistent even on day 14 or day 60 in case of AQP5 expression. Interestingly, external 60Co gamma-irradiation at a dose of 2 Gy did not change the expression of these genes (with excluding of slightly increased AQP5 gene expression on 3rd day after irradiation). Our data suggest that internal exposure to 56MnO2, even at low doses, has a significant biological impact on the lungs altering the gene expression levels for a prolonged period of time, when it is compared with the effects of external radiation.

Conclusions. All this suggests that the effect of 56MnO2 sprayed microparticles, even with small average doses of internal light irradiation (0.11 Gy), has a very significant biological effect on this organ, as evidenced by a change in the expression levels of AQP5 genes over a very long period of time - in comparison with the external gamma irradiation of 60Co in substantially higher doses (2 Gy). Exposure to dispersed non-radioactive MnO2 did not result in a change in the expression of the studied genes compared to the control.

Key words: Manganese-56, radiation induced lung injury, internal radiation exposure, rats, A-bombing.

 

Түйіндеме

56MnO2 РАДИОБЕЛСЕНДІ ҰНТАҒЫМЕНІШКІ ӘСЕР ЕТУДЕН КЕЙІН ЕГЕУҚҰЙРЫҚТАР ӨКПЕСІНДЕГІ АКВАПОРИН 1 МЕН 2 ЭКСПРЕССИЯСЫ

 

Ынкар О. Кайрханова 1, httр://оrcid.оrg/0000–0001–9533–1723

Нариаки Фуджимото 2, httр://оrcid.оrg/0000–0002–8570–4001

Найля Ж. Чайжунусова 1, httр://оrcid.оrg/0000–0002–6660–7118

Масахару Хоши 2, httр://оrcid.оrg/0000–0001–6978–0883

Валерий Ф. Степаненко 3, http://orcid.org/0000-0002-3541-0515

 

1 Семей қаласының Мемлекеттік медицина университеті, Семей қ., Қазақстан;

2 Хиросима Университеті, Хиросима қ., Жапония;

3 Ресей Федерциясының Денсаулық сақтау Министрлігінің «Ұлттық медициналық радиологиялық зерттеу орталығы» Федералды мемлекеттік бюджет мекемесінің филиалы А.Ф. Цыбы атындағы медициналық радиологиялық ғылыми орталығы, Обнинск қ., Ресей Федерциясы.

 

Кіріспе: Радионуклид 56Mn (T1/2 = 2,58 сағ) ядролық жарылыстар кезінде көтерілген топырақ шаңы бөлшектерінің нейтрондық белсендендірілуінен кейінгі алғашқы сағаттардағы негізгі нейтронды –белсендендірілген бета- және гамма сәулелендіргіштердің бірі болып табылады. 56MnO2 шаң тәрізді микробөлшектерімен экспозицияны моделдеу мақсатында атом реакторында Mn тұрақты атомдарының нейтронды белсендендірілуі нәтижесінде алынған 56MnO2 диспергирленген ұнтағымен эксперименталды жануарларға әсер етумен тәжірибелер жүргізілді.

Мақсаты. Диспергирленген 56MnO2 ұнтағының егеуқұйрықтардың өкпедегі гендер экспрессиясына әсерін зерттеу.

Материалдар мен әдістер. Зерттеу дизаины: эксперименталды. Қойылған мақсатқа жету үшін салмағы 220-230 г болатын, 10 апталық ақ зертханалық «Wistar» тұқымының 58 егеуқұйрықтарына эксперимент жүргізілді. Егеуқұйрықтар 5 топқа бөлінд: 56MnO2 (0,05 Гр), 56MnO2 (0,11 Гр), MnO260Co және бақылау. Зерттеу 3, 14 және 60 күндері жүргізілді.Статистикалық талдау. Барлық мәндер орташа шама ± стандартты қате (S.E.) түрінде көрсетілген. Экспонирленген және бақылау топтарын салыстыру үшін Стьюденттің t-критерийі қолданылды. Бақылау тобымен салыстырғанда гендер экспрессиясының өзгерісі сенімді болып p <0,01 немесе p <0,05 болған жағдайда статистикалық мәнді деп саналды.

Нәтижелері. Диспергирленген Ішкі сәулелену дозасы 0,05 және 0,11 Гр болатын56MnO2 ұнтағымен әсер еткеннен кейін AQP1 генінің экспрессиясы алғашқы 3 тәулікте жоғарлады, ал AQP5 генінің экспрессиясы 3, 14 және 60 тәуліктерде де жоғары болды. Ал сыртқы 2 Гр дозадағы 60Co гамма сәулелену бақылау тобымен салыстырғанда бұл гендердің экспрессиясын өзгертпейді. Тек 3-ші тәулікте AQP5 гені экспрессиясы қысқа мерзімге жоғарлады.

Қорытынды. Эксперимент нәтижесі бойынша56MnO2 микробөлшектерімен әсер ету, тіпті өкпенің аз дозада (0,11 Гр), ішкі сәулеленуі бұл мүшеге біршама биологиялық әсер көрсететіні анықталды. Оған жоғары дозадағы (2 Гр) 60Со гамма сәулеленумен салыстырғанда 56Mn микробөлшектерімен әсер ету тобындағы егеуқұйрықтар өкпесінің AQP5 гендер экспрессиясы деңгейінің ұзақ уақыт бойы өзгеруі дәлел болды.

Негізгі сөздер: Марганец-56, радиационды-индуцирленген өкпезақымданулары, ішкісәулелену, егеуқұйрықтар, атомдықжарылыстар.

  

Библиографическая ссылка:

Кайрханова Ы.О., Фуджимото Н.,Чайжунусова Н.Ж., Хоши М., СтепаненкоВ.Ф. Экспрессия аквапоринов 1 и 5 в легких крыс после внутреннего воздействия радиоактивным порошком 56MnO2  / / Наука и Здравоохранение. 2017. №3. С. 50-62.

Kairkhanova Y.O., Fujimоtо N., Chaizhunusоva N.Zh., Hоshi M., Stерanеnkо V.F. The expression of aquaporins 1 and 5 in rat lung after internal expose to radioactive 56MnO2 powder. Nauka i Zdravookhranenie [Science & Healthcare]. 2017, 3, pp. 50-62.

Кайрханова Ы.О., Фуджимото Н.,Чайжунусова Н.Ж., Хоши М., СтепаненкоВ.Ф. 56MnO2 радиобелсенді ұнтағымен ішкі әсер етуден кейін егеуқұйрықтар өкпесіндегі аквапорин 1 мен 2 экспрессиясы / / Ғылым және Денсаулық сақтау. 2017. №4. Б. 50-62.

 

Введение

Как известно, 56Mn (T1/2 = 2,58 час) излучает гамма-кванты и бета частицы, являясь одним из основных радиоизотопов, потенциально способствующих радиационному облучению пострадавших людей, в результате взрыва атомной бомбы в Хиросиме в 1945 году, в добавок к первоначальному излучению [20, 9].

С целью моделирования экспозиции пылевидными микрочастицами 56Mn, были проведены эксперименты при воздействии на экспериментальных крыс диспергированным порошком 56MnO2,полученным в результате нейтронной активации стабильных атомов Mn на ядерном реакторе. Оценки средних (на орган) доз внутреннего облучения экспериментальных крыс линии Вистар при воздействии диспергированным порошком 56MnO2 были проведены нами ранее [18]. Показано, что самая большая доза внутреннего облучения от 56MnO2 была в органах ЖКТ, а кожа и легкие были облучены в меньших дозах [18]. В тонком кишечнике было обнаружено повышение митоза в криптах кишечника [16], но это не было неожиданном, так как доза облучения составляла около 1,3 Гр [18]. Весьма интересно отметить, что в легких произошли весьма значительные патологические изменения, в том числе очаговые кровоизлияния и эмфизема [16], хотя средняя (по органу) доза внутреннего облучения была относительно малой (0,11 Гр) [18].

Известно, что гамма-облучение большими дозами области легких лабораторных животных может вызвать "радиационный пневмонит", а в последующем может развиться фиброз легких, что отмечено также и при облучении человека [2, 23]. Исследования на крысах показали, что облучение в дозе 20 Гр не вызывает гистологических изменения в ткани легких в краткие сроки после радиационного воздействия, хотя через два месяца после облучения были отмечены очаговые экссудативные повреждения, а на шестом месяце - фиброз легких [22, 6].

В работах зарубежных ученых [3, 11] особое внимание было уделено изучению биологической реакции на воздействие ионизирующего излучения при лучевой терапии. Имеющиеся данные свидетельствуют о том, что изменения в экспрессии водных каналов молекул-аквапорин-1 (AQP) и аквапорин-5, играют определенную роль в развитии радиационно-индуцированного повреждения легких [19].

Целью данной работы является представить результаты исследований изменения экспрессии генов мРНК AQP1 и AQP5 в ткани легких экспериментальных крыс после воздействия диспергированным 56MnO2.

Материалы и методы

Дизайн исследования – экспериментальный.

Исследования проведены в тех же условиях экспозиции 56MnO2, что представлены в работах [18, 16] при средних (по органу) дозах внутреннего облучения легких 0,05 Гр и 0,11 Гр [18]. Для сравнения аналогичные исследования проведены при внешнем облучении 60Со и при воздействии диспергированным не радиоактивным порошком MnO2, а также в контрольной группе (без экспозиции радиоактивным и стабильным MnO2 и без облучения).

Экспериментальные животные

В исследование были включены десятинедельные крысы-самцы линии Вистар, приобретенные в Казахском Научном центре карантинных и зоонозных заболеваний, Алматы, Казахстан. Эксперимент был рассмотрен и утверждён Этическим комитетом Государственного медицинского университета г. Семей, Казахстан (Протокол № 5 от 16.04.2014 г.), в соответствии с Директивой Европейского парламента по защите животных, используемых для научных целей [5, 1]. Всего было использовано 58 животных. Животных содержали со свободным доступом к основной диете и водопроводной воде. Экспериментальные животные были разделены на пять групп:

  1. Воздействие распыленным порошком 56MnО2 – средняя (на орган) доза внутреннего облучения 0,05 Гр;
  2. Воздействие распыленным порошком 56MnО2 – средняя (на орган) доза внутреннего облучения 0,11 Гр;
  3. Облучение 60Co – доза внешнего облучения всего тела 2 Гр;
  4. Воздействие распыленным порошком с нерадиоактивным MnО2;
  5. Контрольная группа (без экспозиции радиоактивным и стабильным Mn и без облучения);

Для изучения динамики изменения экспрессии генов животные из всех групп (включая контрольную группу) подвергались эвтаназии (внутрибрюшинное введение большой дозы кетамина) в различные сроки после облучения - на 3, 14 и 60 сутки после воздействия радиоактивным и нерадиоактив-ным порошком MnО2, или же после гамма-облучения.

Для выделения РНК образцы ткани легкого были сохранены в «RNA-Save solution» (Biological Industries, Кромвель, CT, США).

Методика облучения и дозиметрия внутреннего облучения органов крыс

Методика облучения с использованием нейтронно-активированного 56MnO2 и оценки дозы внутреннего облучения, а также результаты оценок доз подробно представлены в работах, опубликованных ранее [18, 1].

Вкратце, 56MnO2 был получен путем нейтронной активации 100 мг порошка MnO2 с использованием ядерного реактора Байкал-1 в Национальном ядерном центре, г.Курчатов, Казахстан. Флюенс тепловых нейтронов составлял 8×1014 н/см2 и 1,6×1015 н/см2 (для двух вариантов облучения – с более высокой и более низкой активностями 56Mn, соответст-венно). Через 6 мин после окончания нейтронной активации была начата экспозиция экспериментальных животных порошком 56Mn. Активированный порошок (56MnO2) распыляли в специальных боксах, содержащий по шесть крыс в каждом. Через 1 час все крысы были перемещены в «чистые» боксы.

Поглощенные дозы внутреннего бета- и гамма-облучения органов, тканей и всего тела определяли на основе данных измерения удельной активности 56Mn в органах и тканях животных в различные сроки после облучения, с использованием результатов стохастичес-кого моделирования взаимодействия ионизирующего излучения с веществом (метод Монте-Карло, версия MCNP-4С) и с применением математического фантома экспериментальной крысы [18, 1]. Средние (на орган) дозы внутреннего облучения в легких составили 0,051±0,011 Гр и 0,11±0,023 Гр, - в первой 56Mn и во второй группе 56Mn, соответственно. Дозы внутреннего облучения всего тела составили 0,09 ±0,026 и 0,14±0,03 Гр, соответственно.

Гамма-облучение источником 60Co в дозе 2 Гр на все тело (мощность дозы 2,6 Гр/мин) проводили с использованием чешского радиотерапевтического устройства «Teragam K–2 unit» (UJP Praha, Praha-Zbraslav, Чехия). Во время экспозиции животных помещали в специально сконструированные боксы из органического стекла с отдельными отсеками для каждой крысы. Облучение проводили с верхней (в дозе 1 Гр) и нижней (в дозе 1 Гр) поверхности бокса. Для измерения дозы от облучения 60Co использовали радиофото-люминесцентные стеклянные дозиметры GD-302M (Chiyoda Technol Co., Токио, Япония).

Определение экспрессии генов мРНК с помощью количественного ОТ–ПЦР метода (метод полимеразной цепной реакции с этапом обратной транскрипции)

Из образцов ткани легких, хранящегося в «RNA Save solution» с использованием «Изогена II» (Nippon Gene Co., Токио, Япония) была выделена общая РНК (матричная, рибосомная и информационная). Первую цепь кДНК синтезировали путем инкубирования 2 µг общего РНК с 200 U M-MLV обратной транскриптазы (Invitrogen/Life Technologies Co., Карлсбад, Калифорния, США) с 100 пмоль олиго-дТ(24) праймера. С помощью количественного ПЦР прибора (StepOnePlus (Applied Biosystems/Life Technologies Co.) проводили измерения кДНК с использованием KAPA SYBR Fast qPCR Kit (Kapa Biosystems, Inc., Woburn, MA, USA). Для каждой мРНК (таблица 1) был предназначен конкретный набор праймеров (таблица 1).

До количественного анализа полученные ПЦР продукты разделялись и очищались с помощью гель-электрофореза. С использо-ванием капиллярного ДНК секвенсора подтверждалась последовательность ДНК (310 Genetic Analyzer; Applied Biosystems/Life Technologies Co.). Условия ПЦР: начальная стадия денатурации 30 с последующими 40 циклами по 5 с при температуре 95°С и 35 с при 60°С. Измеренные уровни мРНК нормализованы со ссылкой на уровни бета-актина мРНК [7].

 

 

Таблица 1.

Праймеры, использованные при анализе количественным методом ОТ-ПЦР (количественный метод Полимеразной Цепной Реакции с этапом Обратной Транскрипции).

Гены

Уникальный идентификатор записи после-довательности в GenBank

Последовательности выбранных праймеров (5 -> 3)

Прямая

Обратная

AQ1

NM_012778

 

CCACTGGAGAGAAACCAGACG

CTGAGCAGAAGCCCCAGTGT

AQ5

NM_012779

AGGCATCCTGTACTGGCTGG

GAGGAGAAGATGCAGAGGGCT

 


Статистический анализ

Все значения выражены в виде средних величин ± стандартная ошибка (S.E.). Использовали t-критерий Стьюдента для сравнения между экспонированными и контрольными группами. Было принято считать достоверными изменения экспрессии генов по сравнению с контролем при p <0,01 или p <0,05.

Результаты

Изменения веса легких.

Относительный вес легких на 3, 14 и 60 сутки после воздействия диспергированным 56Mn02 в дозе 0,05 и 0,11 Гр, 60Co гамма-облучения в дозе 2 Гр и после воздействия диспергированным Mn02в сравнении с контролем приведены в таблице 2. Не было существенных различий в относительном весе легких крыс после воздействия диспергированным Mn02, 60Co гамма-облучением и в контрольных группах в каждые исследуемые сроки, хотя относительный вес легких уменьшался по мере роста крыс. Однако, в группах 56Mn02относительный вес легких был значительно выше по сравнению с контрольной группой, но на 60-й день данные вернулись к контрольным значениям.

 

Таблица 2.

Относительный вес легких у крыс, после воздействия диспергированным 56Mn02 в дозе 0,05 и 0,11 Гр, гамма-облучения 60Co и после воздействия диспергированным Mn02 по сравнению с контролем.

Группа

Период исследования

3 день

14 день

60 день

56MnО2 – средняя (на орган) доза внутреннего облучения 0,05 Гр

4,8±0,65

6,9±0,51*

4,6±0,83

56MnО2 – средняя (на орган) доза внутреннего облучения 0,11 Гр

5,5±0,59

6,7±0,09**

4,5±0,36

60Co гамма-облучения

5,1±0,32

4,8±0,39

4,7±0,59

Нерадиоактивный MnО2;

4,8±0,33

4,2±0,22

4,6±1,16

Контрольная группа

5,5±0,62

4,7±0,21

3,8±0,40

Каждое значение показывает относительную массу легкого (г / кг массы тела, среднее ± стандартная ошибка) и * указывает на значительное отличие каждой группы по сравнению с контролем, p <0,05 (*) и p <.01 (**).

 


Экспрессия генов мРНК в легких.

Изменения в экспрессии AQP1 и AQP5 в легких на 3, 14 и 60 сутки после воздействия диспергированным 56Mn02, гамма-облучения 60Co и после воздействия диспергированным Mn02 по сравнению с контролем приведены в таблицах 3-6.

а) При экспозиции диспергированным 56MnО2 при дозе внутреннего облучения легких 0,05 Гр и 0,11 Гр получены следующие результаты:

- Экспрессия гена AQР1 по сравнению с контролем была увеличена на третьи сутки после воздействия при дозе внутреннего облучения легких 0,05 Гр (p<0,01) и дозе 0,11 Гр (p<0,05).

- Установлено стойкое увеличение экспрес-сии гена AQР5 по сравнению с контролем - в период от трех до 60-и суток после воздействия при дозах внутреннего облучения легких 0,05 Гр и 0,11 Гр (p<0,01 и p<0,05).

б) Далее следует отметить, что внешнее гамма-облучение (60Co) в дозе 2 Гр на все тело не изменило экспрессию исследуемых генов по сравнению с контролем, за исключением кратковременного (на третьи сутки) повышения экспрессии гена AQP5 (p<0,05). В группе с экспозицией нерадиоактивным диспергированным MnО2, экспрессии каждого исследуемого гена не отличались достоверно от контроля во все сроки наблюдения.

 

 

Таблица 3.

Изменение уровней экспрессии мРНК генов AQР1 и AQР5 в различные сроки после воздействия диспергированным радиоактивным порошком 56Mn02 при дозе внутреннего облучения легких0.05 Гр по сравнению с контролем.

Экспозиция диспергированным радиоактивным порошком 56Mn02 при дозе внутреннего облучения легких0.05 Гр и контроль *)

Гены

Уровень экспрессии  мРНК генов (fg/100pg βact) в зависимости от периода времени после окончания воздействия

Через 3 суток

Через 14 суток

Через 60 суток

Экспозиция

AQ1

0,40±0,04**

0,46±0,04

0,47±0,10

Контроль

0,21±0,02

0,36±0,07

0,30±0,11

Экспозиция

AQ5

5,41±0,06*

5,82±0,89*

5,03±0,38**

Контроль

2,61±0,55

3,49±0,17

3,08±0,30

Таблица 4.

Изменение уровней экспрессии мРНК генов AQР1 и AQР5 в различные сроки после воздействия диспергированным радиоактивным порошком 56Mn02 при дозе внутреннего облучения легких0.11 Гр по сравнению с контролем.

Экспозиция диспергированным радиоактивным порошком 56Mn02 при дозе внутреннего облучения легких  0.11 Гр и контроль *)

Гены

Уровень экспрессии  мРНК генов (fg/100pg βact) в зависимости от периода времени после окончания воздействия

Через 3 суток

Через 14 суток

Через 60 суток

Экспозиция

AQ1

0,42±0,14*

0,31±0,10

0,23±0,04

Контроль

0,21±0,02

0,36±0,07

0,30±0,11

Экспозиция

AQ5

5,24±0,98*

4,44±0,32*

4,32±0,57*

Контроль

2,61±0,55

3,49±0,17

3,08±0,30

 

Таблица 5.

Изменение уровней экспрессии мРНК генов AQР1 и AQР5 в различные сроки после гамма-облучения 60Co при дозе на все тело 2 Гр по сравнению с контролем.

Внешнеее гамма-облучение 60Co при дозе на все тело 2Гр и контроль *)

Гены

Уровень экспрессии мРНК генов (fg/100pg βact) в зависимости от периода времени после окончания воздействия

Через 3 суток

Через 14 суток

Через 60 суток

Облучение

AQ1

0,37±0,11

0,34±0,04

0,32±0,09

Контроль

0,21±0,02

0,36±0,07

0,30±0,11

Облучение

AQ5

3,85±0,25*

4,12±0,22

3,41±0,18

Контроль

2,61±0,55

3,49±0,17

3,08±0,30

 

Таблица 6.

Изменение уровней экспрессии мРНК генов AQР1 и AQР5 в различные сроки после воздействия диспергированным нерадиоактивным порошком Mn02 по сравнению с контролем.

Экспозиция диспергированным нерадиоактивным порошком Mn02 и контроль *)

Гены

Уровень экспрессии мРНК генов (fg/100pg βact) в зависимости от периода времени после окончания воздействия

Через 3 суток

Через 14 суток

Через 60 суток

Экспозиция

AQ1

0,19±0,03

0,38±0,06

0,27±0,06

Контроль

0,21±0,02

0,36±0,07

0,30±0,11

Экспозиция

AQ5

1,85±0,06

3,02±0,18

2,51±0,32

Контроль

2,61±0,55

3,49±0,17

3,08±0,30

*)**)Примечания к таблицам 2-5: подчеркиванием и жирным  текстом выделены показатели экспрессии исследованных генов, которые признаны достоверными по сравнению с контролем (*) p < 0,05; **) - p <0,01).

 


Обсуждение

В настоящей работе были исследованы эффекты воздействия диспергированным порошком 56MnO2 на экспрессию мРНК генов AQР1 и AQР5, которые, предположительно, на молекулярном уровне связаны с начальными этапами развития радиацинно-индуцированных последствий. Установлено стойкое увеличение экспрессии гена AQР5 по сравнению с контролем - в период от трех до 60-и суток после воздействия при дозах внутреннего облучения легких 0,05 Гр и 0,11 Гр. Между тем, в группе с внешним гамма-облучение 60Co в дозе 2 Гр на все тело изменений экспрессии исследованных генов не отмечено по сравнению с контролем, за исключением кратковременного (на третьи сутки) повышения экспрессии гена AQР5. В группе с экспозицией нерадиоактивным диспергированным MnО2, экспрессии каждого исследуемого гена не отличались достоверно от контроля на всех сроках наблюдения.

Ранее нами также было сообщено о наличии патологических изменений в тонком кишечнике и легких у крыс линии Вистар после воздействия диспергированным порошком 56MnO2 по сравнению с внешним гамма-облучением 60Co в дозе 2 Гр на все тело [16]. При этом число митотических клеток в тонком кишечнике увеличилось уже на 3-й день после воздействия 56MnO2, что неудивительно, так как поглощенная доза внутреннего облучения в тонком кишечнике составляла 1,3 Гр.

Эти данные свидетельствуют о том, что внутреннее облучение после воздействия распыленным порошком 56MnO2 вызывает более существенные биологические эффекты в ткани легких по сравнению с внешним облучением.

Что касается данных литературы, то известно, что облучение лабораторных животных в больших дозах может вызвать "радиационный пневмонит" с последующим развитием фиброза легких, что прослеживается также и у человека [6, 12]. Так как лучевые повреждения легких являются основным дозоограничивающим фактором при лучевой терапии области грудной клетки, то этот вопрос был достаточно широко исследован [11, 4], хотя все еще остаются актуальными вопросы, относящиеся к изучению молекулярных механизмов, обусловливающих эти эффекты [10, 13, 17, 21 20-23]. Следует отметить также исследования по изучению влияния внутреннего корпускулярного облучения легких лабораторных животных такими радионуклидами как 144Ce, 147Pm, 144Ce и 90Sr [8, 14, 15, 24-26]. Однако эти исследования были ориентированы только на смертность от радиационного пневмонита и фиброза или случаев канцерогенеза легких [8, 14,15, 24-26].

В облученных легких отмечалась экспрессия генов AQPs - семейство водно-селективных каналов. Функцию облегчения плазменной проницаемости мембраны для воды и движение жидкости обеспечивает выраженные по всему телу - AQPs [10]. В легком, AQP1 экспрессируется в эндотелии капилляров, а в альвеолярном эпителии AQP5, и они оба могут играть важную роль в физиологии и патологии легких [17]. Сообщалось, что у мышей экспрессия мРНК AQP1 и AQP5 в легких снижается через неделю после заражения аденовирусом [21]. В недавних литературных источниках отмечено, что через неделю после рентгеновского облучения грудной клетки в дозе 17 Гр у крыс уровень мРНК AQP1 снижается, а уровень мРНК AQP5 повышается [19]. Эти исследования предполагают, что изменения в экспрессии AQP1 и AQP5 участвуют в патогенезе легких, включая воспаление и эмфиземы. Наши данные также показали, что уровень мРНК AQP5 повысился после воздействия 56Mn, и постоянно повышался до 60-х суток в обеих группах 56MnО2. В группе 60Со, уровень экспрессии AQP5 повышался на 14-е сутки, и вернулся к контрольному уровню на 60-е сутки. Значительное увеличение относительного веса легких на 14-й день может быть следствием увеличения экспрессии AQP5.

Таким образом, экспрессия мРНК AQP5 может быть чувствительным маркером, определяющим повреждения легких на молекулярном уровне, до появления патологических изменений.

Известно, что, 56Mn излучает не только гамма-кванты, а также бета-частицы. Поэтому наличие бета-частиц может быть существенным фактором, который необходимо учитывать при интерпретации биологических эффектов при внутреннем облучении 56Mn.

В настоящей работе изложены только первые результаты проведенных нами исследований. Необходимы дальнейшие исследования в определении механизмов экспрессии генов в тканях легких при внутреннем облучении диспергированным 56Mn, а также дозиметрические исследования по выяснению роли бета-облучения на уровне микроструктур тканей легких. Действительно, включение отдельных микрочастиц 56Mn или же кластеров этих частиц в ткань легких может вызвать большие уровни облучения в местах локализации микрочастиц с 56Mn.

Заключение

В данной работе исследовали эффекты влияния диспергированного нейтронно-активированного порошка 56MnO2 на экспрессию ряда мРНК генов в тканях легких у крыс линии Вистар в течение 60-и дней. Несмотря на то, что дозы внутреннего облучения легких были относительно низкими (не более 0,11 Гр), в экспрессии генов AQP5 наблюдались значимые и стойкие изменения по сравнению с контролем. Между тем, в группе с внешним гамма-облучением 60Co в дозе 2 Гр на все тело изменений экспрессии всех исследованных генов не отмечено по сравнению с контролем, за исключением кратковременного (на третьи сутки) повышения экспрессии гена AQP5. В группе с экспозицией нерадиоактивным диспергиро-ванным MnО2, экспрессии каждого исследуемого гена достоверно не отличались от контроля на всех сроках наблюдения.

Эти данные свидетельствуют о том, что внутреннее облучение после воздействия распыленным порошком 56MnO2 вызывает более существенные биологические эффекты в тканях легких по сравнению с внешним облучением.

Полученные данные могут быть полезными для оценки значимости облучения от радиоактивной пыли, попавшей внутрь организма ингаляционным путем, - для понимания и объяснения эффектов атомной бомбардировки Хиросимы и Нагасаки, особенно у лиц, оказавшихся вблизи эпицентров взрывов вскоре после детонации ядерных зарядов, но не подвергшихся прямому гамма-нейтронному облучению в момент детонации. Аналогичное внимание следует уделять окружающей среде и населению, проживающему, как на территории бывшего Семипалатинского полигона, так и на других загрязнённых территорях нашей республики.

 

Соответствие этическим стандартам.

В процессе выполнения работы были соблюдены все международные, национальные и институциональные стандарты работы с экспериментальными животными, что изложено в тексте статьи.

 

Конфликт интересов.

Все авторы статьи, согласно их заявлениям, не имеют конфликта интересов.

 

Вклад авторов

Кайрханова Ы. – набор материала, обработка данных, написание статьи;

Нариаки Ф., Чайжунусова Н.Ж., Хоши М..– научное руководство при проведении эксперимента и при написании статьи.

 

Данное исследование проводилось в рамках Научно-исследовательской работы Государствен-ного медицинского университета г. Семей «Беспрецедентное мультицентровое эксперимен-тальное исследование влияния ионизирующего излучения на живой организм с использованием ядерного реактора», номер гос.регистрации 0115РК03153.

 

Литература:

  1. Степаненко В.Ф., Рахыпбеков Т.К., Каприн А.Д., и др. Облучение экспериментальных животных активирован-ной нейтронами радиоактивной пылью: разработка и реализация метода – первые результаты международного многоцентрового исследования // Радиация и риск. 2016. Том 25. № 4, C. 111-122.
  2. Coggle J.E., Lambert B.E., Moores S.R. Radiation effects in the lung // Environ. Health Persp. 1986. V. 70. P. 261-291.
  3. Dagle G.E., Sanders C.L. Radionuclide injury to the lung // Environ. Health Persp.  1984. V. 55. P. 129-137.
  4. Ding N.H., Li J.J., Sun L.Q. Molecular mechanisms and treatment of radiation-induced lung fibrosis // Curr. Drug Targets. 2013. V. 14. P. 1347-1356.
  5. Directive 2010/63/EU of the European Parliament and the Council of the Office on the protection of animals used for scientific purposes of 22 September 2010 // Offic. J. of the Europ. Union. 2010. L276. P. 33-79. 15.
  6. Down J.D. The nature and relevance of late lung pathology following localised irradiation of the thorax in mice and rats // Brit. J. Cancer Suppl. 1986. V. 7. P. 330-332.
  7. Fujimoto N., Suzuki T., Ohta S., Kitamura S. Identification of rat prostatic secreted proteins using mass spectrometric analysis and androgen-dependent mRNA expression // J. Androl. 2009. V. 30. P. 669-678.
  8. Hahn F.F., Scott B., Lundgren D.L. Comparative stochastic effects of alpha, beta or x-irradiation of the lung of rats // Health phys. 2010. V. 99. P. 363-366.
  9. Imanaka T., Endo S., Tanaka K., Shizuma K. Gamma-ray exposure from neutron-induced radionuclides in soil in Hiroshima and Nagasaki based on DS02 calculations // Radiat. Environ. Bioph. 2008. V. 47, N 3. P. 331-336.
  10. King L.S., Agre P. Pathophysiology of the aquaporin water channels // Ann. Rev. Physiol. 1996. V. 58. P. 619-648.
  11. Marks L.B., Yu X., Vujaskovic Z., Small W., Folz R., Anscher M.S. Radiation-induced lung injury // Semin. Radiat. Oncol. 2003. V. 13. P. 333-345.
  12. Mehta V. Radiation pneumonitis and pulmonary fibrosis in non-small-cell lung cancer: Pulmonary function, prediction, and prevention // Int. J. Radiat. Oncol. Biol. Phy. 2005. V. 63. P. 5–24.
  13. Pohlers D., Brenmoehl J., Löffler I., Müller C.K., Leipner C., Schultze-Mosgau S., Stallmach A., Kinne R.W., Wolf G. TGF-β and fibrosis in different organs - molecular pathway imprints // Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 2009. V. 1792. P. 746-756.
  14. Scott B.R., Hahn F.F., Newton G.J., Snipes M.B., Damon E.G., Mauderly J.L., Boecker B.B., Gray D.H. Experimental studies of the early effects of inhaled beta-emitting radionuclides for nuclear accident risk assessment, Washinton, D.C.: U.S. 1987. Nuclear Regulatory Commission: NUREG/ CR-5067, LMF-117.
  15. Scott B.R., Hahn F.F., Snipes M.B., Newton G.J., Eidson A.F., Mauderly J.L., Boecker B.B. Predicted and observed early effects of combined alpha and beta lung irradiation // Health phys. 1990. V. 59. P. 791-805.
  16. Shichijo K., Fujimoto N., Uzbekov D., Kairkhanova Y., Saimova A., Chaizhunusova N., Sayakenov N., Shabdarbaeva D., Aukenov N., Azimkhanov A., Kolbayenkov A., Mussazhanova A., Niino D., Nakashima M., Zhumadilov K., Stepanenko V., Tomonaga M., Rakhypbekov T., Hoshi M. Internal exposure to neutron-activated 56Mn dioxide powder in Wistar rats – Part 2: Pathological effects // Radiation and Environmental Biophysics. 2017. V. 56, N 1. P. 55–61.
  17. Song Y., Fukuda N., Bai C., Ma T., Matthay Ma., Verkman A.S. Role of aquaporins in alveolar fluid clearance in neonatal and adult lung, and in oedema formation following acute lung injury: studies in transgenic aquaporin null mice // J. physiol. 2000. V. 525. P. 771-779.
  18. Stepanenko V., Rakhypbekov T., Otani K., Endo S., Satoh K., Kawano N., Shichijo K., Nakashima M., Takatsuji T., Sakaguchi A., Kato H., Onda Y., Fujimoto N., Toyoda S., Sato H., Dyussupov A., Chaizhunusova N., Sayakenov N., Uzbekov D., Saimova A., Shabdarbaeva D., Skakov M., Vurim A., Gnyrya V., Azimkhanov A., Kolbayenkov A., Zhumadilov K., Kairikhanova Y., Kaprin A., Galkin V., Ivanov S., Kolyzhenkov T., Petukhov A., Yaskova E., Belukha I., Khailov A., Skvortsov V., Ivannikov A., Akhmedova U., Bogacheva V., Hoshi M. Internal exposure to neutron-activated 56Mn dioxide powder in Wistar rats – Part 1: Dosimetry // Radiat. Environ. Biophys. 2017. V. 56, N 1. P. 47–54.
  19. Sun C.Y., Zhao Y.X., Zhong W., Liu D.W., Chen Y.Z., Qin L.L., Bai L., Liu D. The expression of aquaporins 1 and 5 in rat lung after thoracic irradiation // J. Radiat. Res. 2014. V. 55. P. 683-689.
  20. Tanaka K., Endo S., Imanaka T., Shizuma K., Hasai H., Hoshi M. Skin dose from neutron-activated soil for early entrants following the A-bomb detonation in Hiroshima: contribution from beta and gamma rays // Radiat. Environ. Biophys. 2008. V. 47, N 3. P. 323-330.
  21. Towne J.E., Harrod K.S., Krane C.M., Menon A.G. Decreased expression of aquaporin (AQP)1 and AQP5 in mouse lung after acute viral infection // Am. J. Respir. Cell. Mol. Biol. 2000. V. 22. P. 34-44.
  22. Travis E.L., Harley R.A., Fenn J.O., Klobukowski C.J., Hargrove H.B. Pathologic changes in the lung following single and multi-fraction irradiation // Int. J. Radiat. Oncol. 1977. V. 2. P. 475-490.
  23. Ward W.F., Kim Y.T., Molteni A., Tsao C., Hinz J.M. Pentoxifylline does not spare acute radiation reactions in rat lung and skin // Radiat. Res. 1992. V. 129. P. 107-111.

 

References:

1.    Stepanenko V.F., Rakhypbekov T.K., Kaprin A.D. i dr., Obluchenie eksperimentalnykh zhivotnykh aktivirovannoi neitronami radioaktivnoi pylyu: razrabotka i realizatsiya metoda – pervye rezultaty mezhdunarodnogo mnogotsentrovogo issledovaniya [Irradiation of laboratory animals by neutron activated dust: development and application of the method – first results of international multicenter study]. Radiatsiya i risk [Radiation and Risk]. 2016, vol. 25, №.4, pp. 111-125. [in Russian]

2.    Coggle J.E., Lambert B.E., Moores S.R. Radiation effects in the lung. Environ. Health Persp. 1986. V. 70. P. 261-291.

3.    Dagle G.E., Sanders C.L. Radionuclide injury to the lung. Environ. Health Persp. 1984. V. 55. P. 129-137.

4.    Ding N.H., Li J.J., Sun L.Q. Molecular mechanisms and treatment of radiation-induced lung fibrosis. Curr. Drug Targets. 2013. V. 14. P. 1347-1356.

5.    Directive 2010/63/EU of the European Parliament and the Council of the Office on the protection of animals used for scientific purposes of 22 September 2010 // Offic. J. of the Europ. Union. 2010. L276. P. 33-79. 15.

6.    Down J.D. The nature and relevance of late lung pathology following localised irradiation of the thorax in mice and rats. Brit. J. Cancer Suppl. 1986. V. 7. P. 330-332.

7.    Fujimoto N., Suzuki T., Ohta S., Kitamura S. Identification of rat prostatic secreted proteins using mass spectrometric analysis and androgen-dependent mRNA expression. J. Androl. 2009. V. 30. P. 669-678.

8.    Hahn F.F., Scott B., Lundgren D.L. Comparative stochastic effects of alpha, beta or x-irradiation of the lung of rats. Health phys. 2010. V. 99. P. 363-366.

9.    Imanaka T., Endo S., Tanaka K., Shizuma K. Gamma-ray exposure from neutron-induced radionuclides in soil in Hiroshima and Nagasaki based on DS02 calculations. Radiat. Environ. Bioph. 2008. V. 47, N 3. P. 331-336.

10.   King L.S., Agre P. Pathophysiology of the aquaporin water channels. Ann. Rev. Physiol. 1996. V. 58. P. 619-648.

11.   Marks L.B., Yu X., Vujaskovic Z., Small W., Folz R., Anscher M.S. Radiation-induced lung injury. Semin. Radiat. Oncol. 2003. V. 13. P. 333-345.

12.   Mehta V. Radiation pneumonitis and pulmonary fibrosis in non-small-cell lung cancer: Pulmonary function, prediction, and prevention. Int. J. Radiat. Oncol. Biol. Phy. 2005. V. 63. P. 5–24.

13.   Pohlers D., Brenmoehl J., Löffler I., Müller C.K., Leipner C., Schultze-Mosgau S., Stallmach A., Kinne R.W., Wolf G. TGF-β and fibrosis in different organs - molecular pathway imprints. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 2009. V. 1792. P. 746-756.

14.   Scott B.R., Hahn F.F., Newton G.J., Snipes M.B., Damon E.G., Mauderly J.L., Boecker B.B., Gray D.H. Experimental studies of the early effects of inhaled beta-emitting radionuclides for nuclear accident risk assessment, Washinton, D.C.: U.S. 1987. Nuclear Regulatory Commission: NUREG/ CR-5067, LMF-117.

15.   Scott B.R., Hahn F.F., Snipes M.B., Newton G.J., Eidson A.F., Mauderly J.L., Boecker B.B. Predicted and observed early effects of combined alpha and beta lung irradiation. Health phys. 1990. V. 59. P. 791-805.

16.   Shichijo K., Fujimoto N., Uzbekov D., Kairkhanova Y., Saimova A., Chaizhunusova N., Sayakenov N., Shabdarbaeva D., Aukenov N., Azimkhanov A., Kolbayenkov A., Mussazhanova A., Niino D., Nakashima M., Zhumadilov K., Stepanenko V., Tomonaga M., Rakhypbekov T., Hoshi M. Internal exposure to neutron-activated 56Mn dioxide powder in Wistar rats – Part 2: Pathological effects. Radiation and Environmental Biophysics. 2017. V. 56, N 1. P. 55–61.

17.   Song Y., Fukuda N., Bai C., Ma T., Matthay Ma., Verkman A.S. Role of aquaporins in alveolar fluid clearance in neonatal and adult lung, and in oedema formation following acute lung injury: studies in transgenic aquaporin null mice. J. physiol. 2000. V. 525. P. 771-779.

18.   Stepanenko V., Rakhypbekov T., Otani K., Endo S., Satoh K., Kawano N., Shichijo K., Nakashima M., Takatsuji T., Sakaguchi A., Kato H., Onda Y., Fujimoto N., Toyoda S., Sato H., Dyussupov A., Chaizhunusova N., Sayakenov N., Uzbekov D., Saimova A., Shabdarbaeva D., Skakov M., Vurim A., Gnyrya V., Azimkhanov A., Kolbayenkov A., Zhumadilov K., Kairikhanova Y., Kaprin A., Galkin V., Ivanov S., Kolyzhenkov T., Petukhov A., Yaskova E., Belukha I., Khailov A., Skvortsov V., Ivannikov A., Akhmedova U., Bogacheva V., Hoshi M. Internal exposure to neutron-activated 56Mn dioxide powder in Wistar rats – Part 1: Dosimetry. Radiat. Environ. Biophys. 2017. V. 56, N 1. P. 47–54.

19.   Sun C.Y., Zhao Y.X., Zhong W., Liu D.W., Chen Y.Z., Qin L.L., Bai L., Liu D. The expression of aquaporins 1 and 5 in rat lung after thoracic irradiation. J. Radiat. Res. 2014. V. 55. P. 683-689.

20.   Tanaka K., Endo S., Imanaka T., Shizuma K., Hasai H., Hoshi M. Skin dose from neutron-activated soil for early entrants following the A-bomb detonation in Hiroshima: contribution from beta and gamma rays. Radiat. Environ. Biophys. 2008. V. 47, N 3. P. 323-330.

21.   Towne J.E., Harrod K.S., Krane C.M., Menon A.G. Decreased expression of aquaporin (AQP)1 and AQP5 in mouse lung after acute viral infection. Am. J. Respir. Cell. Mol. Biol. 2000. V. 22. P. 34-44.

22.   Travis E.L., Harley R.A., Fenn J.O., Klobukowski C.J., Hargrove H.B. Pathologic changes in the lung following single and multi-fraction irradiation. Int. J. Radiat. Oncol. 1977. V. 2. P. 475-490.

23.   Ward W.F., Kim Y.T., Molteni A., Tsao C., Hinz J.M. Pentoxifylline does not spare acute radiation reactions in rat lung and skin. Radiat. Res. 1992. V. 129. P. 107-111.

 

Контактная информация:

Кайрханова Ынкар Окимхановна – преподаватель кафедры молекулярной биологии и микробиологии,Государственного медицинского университета города Семей, Казахстан.

Почтовый адрес: 071410, Республика Казахстан, Восточно-Казахстанская область, г. Семей, ул. Абая, 103.

E-mail: Inkar1357@mail.com

Телефон: 8-777-764-08-81

год: 2017 выпуск №4